Click on a pdb id to open the data (HTML)
Click on the pdb code and data links (HTML, PDF, Word) for more details. Click on the structures and their diagram to enlarge.
Sort columns by clicking on column heads (shift key for several columns). Reorder columns by drag and dropping. Filter data with the top-right search field, or the filters button. Copy to clipboard or export in .csv, .xlsx. or .pdf from the buttons below.
| PDB | Data | Description | Sequence | Length | Topology | Quartets | Diagram | Structure |
|---|---|---|---|---|---|---|---|---|
| PDB | Data | Description | Sequence | Length | Topology | Quartets | dG | dC | dA | dT | dG | dC | dA | dT | ligand |
| 22AG (143D) | Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex
NOTE: 22AG is polymorphic in KCl solutions, 143D is only one possible conformer |
AGGGTTAGGGTTAGGGTTAGGG | 22 | polymorphic (shown conformer: antiparallel) | NA |
|
|
|
| 1XAV | Major G-quadruplex structure formed in human c-MYC promoter, a monomeric parallel-stranded quadruplex | TGAGGGTGGGTAGGGTGGGTAA | 22 | parallel | 3 |
|
|
|
| 2GKU | Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop | TTGGGTTAGGGTTAGGGTTAGGGA | 24 | hybrid | 3 |
|
|
|
| 2HY9 | Human telomere DNA quadruplex structure in K+ solution hybrid-1 form | AAAGGGTTAGGGTTAGGGTTAGGGAA | 26 | hybrid | 3 |
|
|
|
| 2JPZ | Human telomere DNA quadruplex structure in K+ solution hybrid-2 form | TTAGGGTTAGGGTTAGGGTTAGGGTT | 26 | hybrid | 3 |
|
|
|
| 2JSM | Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop | TAGGGTTAGGGTTAGGGTTAGGG | 23 | hybrid | 3 |
|
|
|
| 2KF8 | Structure of a two-G-tetrad basket-type intramolecular G-quadruplex formed by human telomeric repeats in K+ solution | GGGTTAGGGTTAGGGTTAGGGT | 22 | antiparallel | 2 |
|
|
|
| 2KM3 | Structure of an intramolecular G-quadruplex containing a G.C.G.C tetrad formed by human telomeric variant CTAGGG repeats | AGGGCTAGGGCTAGGGCTAGGG | 22 | antiparallel | 2 |
|
|
|
| 2KPR | Monomeric intronic human chl1 gene quadruplex DNA | GGGTGGGGAAGGGGTGGGT | 19 | hybrid | 3 |
|
|
|
| 2KYP | Monomeric Human CKIT-2 proto-oncogene promoter quadruplex DNA | CGGGCGGGCGCTAGGGAGGGT | 21 | parallel | 3 |
|
|
|
| 2LBY | G-quadruplex structure formed at the 5'-end of NHEIII_1 element in human c-MYC promoter | TAGGGAGGGTAGGGAGGGT | 19 | parallel | 3 |
|
|
|
| 2LEE | G-quadruplexe adopted by a sequence from intron of N-myc gene | TAGGGCGGGAGGGAGGGAA | 19 | parallel | 3 |
|
|
|
| 2LK7 | Monomer-dimer equilibrium for 5'-5' stacking of propeller-type parallel-stranded G-quadruplexes | TTGGGTGGGTGGGTGGGT | 18 | parallel | 3 |
|
|
|
| 2LOD | Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops | GGGATGGGACACAGGGGACGGG | 22 | hybrid | 3 |
|
|
|
| 2LPW | Human CEB25 minisatellite G-quadruplex | AAGGGTGGGTGTAAGTGTGGGTGGGT | 26 | parallel | 3 |
|
|
|
| 2LXQ | Monomeric PilE G-Quadruplex DNA from Neisseria Gonorrhoeae | TAGGGTGGGTTGGGTGGGGAAT | 22 | parallel | 3 |
|
|
|
| 2M4P | Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge | TTGTGGTGGGTGGGTGGGT | 19 | parallel | 3 |
|
|
|
| 2M27 | Major G-quadruplex structure formed in human VEGF promoter, a monomeric parallel-stranded quadruplex | CGGGGCGGGCCTTGGGCGGGGT | 22 | parallel | 3 |
|
|
|
| 2MGN | Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3 | TGAGGGTGGTGAGGGTGGGGAAGG | 24 | parallel | 3 |
|
|
|
| 2N4Y | Structure and possible function of a G-quadruplex in the long terminal repeat of the proviral HIV-1 genome | CTGGGCGGGACTGGGGAGTGGT | 22 | parallel | 3 |
|
|
|
| 2O3M | Monomeric G-DNA tetraplex from human C-kit promoter | AGGGAGGGCGCTGGGAGGAGGG | 22 | parallel | 3 |
|
|
|
| 21G (4DA3) | Crystal structure of an intramolecular human telomeric DNA G-quadruplex 21-mer bound by the naphthalene diimide compound
MM41
NOTE: 21G is polymorphic in KCl solutions, 4DA3 is only one possible conformer |
GGGTTAGGGTTAGGGTTAGGG | 21 | polymorphic (shown conformer: parallel) | NA |
|
|
|
| 5I2V | NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region | AGGGCGGTGTGGGAATAGGGAA | 22 | parallel | 3 |
|
|
|
| 5LQG | A two-quartet G-quadruplex formed by human telomere in KCl solution at neutral pH | TAGGGTTAGGGTTAGGGTTAGG | 22 | antiparallel | 2 |
|
|
|
| 5NYS | M2 G-quadruplex dilute solution | TAGGGACGGGCGGGCAGGGT | 20 | parallel | 3 |
|
|
|
| 5YEY | The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution | GGGTTAGGGTTAGGGTTTGGG | 21 | antiparallel | 3 |
|
|
|
| 6GZN | Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex | GGGTAGGGAGCGGGAGAGGG | 20 | antiparallel | 3 |
|
|
|
| HIV-PRO1 | Two G-tetrad antiparallel G4 with an additional Watson–Crick CG base pair from the HIV-1 promoter region | TGGCCTGGGCGGGACTGGG | 19 | antiparallel | 2 |
|
|
An R package to build and explore G-quadruplex databases
Consolidate results from circular dichroism, 1H-NMR, UV-melting, and native mass spectrometry. Manage buffers, replicates and tunes.
UV-melting data treatment, NMR and MS peak labeling, CD normalisation, extinction coefficient determination, and more!
Filter, select, rescale, colour, and automatically edit Word, HTML or pdf reports
GPL-3 licensed software, data readable natively in R and exportable in .csv, .xlsx or the clipboard
